Coverage for biobb_amber/nab/nab_build_dna_structure.py: 0%
69 statements
« prev ^ index » next coverage.py v7.5.1, created at 2024-05-07 08:11 +0000
1#!/usr/bin/env python3
3"""Module containing the NabBuildDNAStructure class and the command line interface."""
4import argparse
5from pathlib import PurePath
6from biobb_common.generic.biobb_object import BiobbObject
7from biobb_common.configuration import settings
8from biobb_common.tools import file_utils as fu
9from biobb_common.tools.file_utils import launchlogger
10from biobb_amber.nab.common import check_output_path
13class NabBuildDNAStructure(BiobbObject):
14 """
15 | biobb_amber.nab.nab_build_dna_structure NabBuildDNAStructure
16 | Wrapper of the `AmberTools (AMBER MD Package) nab tool <https://ambermd.org/AmberTools.php>`_ module.
17 | Builds a 3D structure from a DNA sequence using nab (Nucleic Acid Builder) tool from the AmberTools MD package.
19 Args:
20 output_pdb_path (str): DNA 3D structure PDB file. File type: output. `Sample file <https://github.com/bioexcel/biobb_amber/raw/master/biobb_amber/test/reference/nab/ref_nab_build_dna_structure.pdb>`_. Accepted formats: pdb (edam:format_1476).
21 properties (dic - Python dictionary object containing the tool parameters, not input/output files):
22 * **sequence** (*str*) - ("GCGCGGCTGATAAACGAAAGC") Nucleotide sequence to convert to a 3D structure. Nucleotides should be written in 1-letter code, with no spaces between them.
23 * **helix_type** (*str*) - ("lbdna") DNA/RNA helix type. Values: arna (Right Handed A-RNA - Arnott), aprna (Right Handed A’-RNA - Arnott), lbdna (Right Handed B-DNA - Langridge), abdna (Right Handed B-DNA - Arnott), sbdna (Left Handed B-DNA - Sasisekharan), adna (Right Handed A-DNA - Arnott).
24 * **compiler** (*str*) - ("gcc") Alternative C compiler for nab.
25 * **linker** (*str*) - ("gfortran") Alternative Fortran linker for nab.
26 * **binary_path** (*str*) - ("nab") Path to the nab executable binary.
27 * **remove_tmp** (*bool*) - (True) [WF property] Remove temporal files.
28 * **restart** (*bool*) - (False) [WF property] Do not execute if output files exist.
29 * **container_path** (*str*) - (None) Container path definition.
30 * **container_image** (*str*) - ('afandiadib/ambertools:serial') Container image definition.
31 * **container_volume_path** (*str*) - ('/tmp') Container volume path definition.
32 * **container_working_dir** (*str*) - (None) Container working directory definition.
33 * **container_user_id** (*str*) - (None) Container user_id definition.
34 * **container_shell_path** (*str*) - ('/bin/bash') Path to default shell inside the container.
36 Examples:
37 This is a use example of how to use the building block from Python::
39 from biobb_amber.nab.nab_build_dna_structure import nab_build_dna_structure
40 prop = {
41 'sequence': 'GCGCGGCTGATAAACGAAAGC'
42 }
43 nab_build_dna_structure(output_pdb_path='/path/to/newStructure.pdb',
44 properties=prop)
46 Info:
47 * wrapped_software:
48 * name: AmberTools nab
49 * version: >20.9
50 * license: LGPL 2.1
51 * ontology:
52 * name: EDAM
53 * schema: http://edamontology.org/EDAM.owl
55 """
57 def __init__(self, output_pdb_path, properties, **kwargs):
59 properties = properties or {}
61 # Call parent class constructor
62 super().__init__(properties)
63 self.locals_var_dict = locals().copy()
65 # Input/Output files
66 self.io_dict = {
67 'in': {},
68 'out': {'output_pdb_path': output_pdb_path}
69 }
71 # Properties specific for BB
72 self.properties = properties
73 self.sequence = properties.get('sequence', "GCGCGGCTGATAAACGAAAGC")
74 self.helix_type = properties.get('helix_type', "lbdna")
75 self.compiler = properties.get('compiler', "gcc")
76 self.linker = properties.get('linker', "gfortran")
77 self.binary_path = properties.get('binary_path', 'nab')
79 # Check the properties
80 self.check_properties(properties)
81 self.check_arguments()
83 def check_data_params(self, out_log, err_log):
84 """ Checks input/output paths correctness """
86 # Check output(s)
87 self.io_dict["out"]["output_pdb_path"] = check_output_path(self.io_dict["out"]["output_pdb_path"], "output_pdb_path", False, out_log, self.__class__.__name__)
89 @launchlogger
90 def launch(self):
91 """Launches the execution of the NabBuildDNAStructure module."""
93 # check input/output paths and parameters
94 self.check_data_params(self.out_log, self.err_log)
96 # Setup Biobb
97 if self.check_restart():
98 return 0
99 self.stage_files()
101 # Creating temporary folder
102 # self.tmp_folder = fu.create_unique_dir()
103 # fu.log('Creating %s temporary folder' % self.tmp_folder, self.out_log)
105 # create .nab file
106 # molecule m;
107 # m = fd_helix( "abdna", "aaaaaaaaaa", "dna" );
108 # putpdb( "nuc.pdb", m, "-wwpdb");
110 acid_type = 'dna'
111 if ("rna" in self.helix_type):
112 acid_type = 'rna'
114 # Creating temporary folder & Leap configuration (instructions) file
115 if self.container_path:
116 instructions_file = str(PurePath(self.stage_io_dict['unique_dir']).joinpath("nuc.nab"))
117 instructions_file_path = str(PurePath(self.container_volume_path).joinpath("nuc.nab"))
118 self.tmp_folder = None
119 else:
120 self.tmp_folder = fu.create_unique_dir()
121 instructions_file = str(PurePath(self.tmp_folder).joinpath("nuc.nab"))
122 fu.log('Creating %s temporary folder' % self.tmp_folder, self.out_log)
123 instructions_file_path = instructions_file
125 # instructions_file = str(PurePath(self.tmp_folder).joinpath("nuc.nab"))
126 with open(instructions_file, 'w') as nabin:
127 nabin.write("molecule m; \n")
128 nabin.write("m = fd_helix( \"" + self.helix_type + "\", \"" + self.sequence + "\", \"" + acid_type + "\" ); \n")
129 nabin.write("putpdb( \"" + self.stage_io_dict['out']['output_pdb_path'] + "\" , m, \"-wwpdb\");\n")
131 # Command line
132 if self.container_path:
133 nuc_path = self.container_volume_path
134 self.cmd = [self.binary_path,
135 '--compile', self.compiler,
136 '-Xlinker', self.linker,
137 instructions_file_path,
138 ' ; ' + nuc_path + '/nuc'
139 ]
140 else:
141 nuc_path = './' + self.tmp_folder
142 self.cmd = [self.binary_path,
143 '--compiler', self.compiler,
144 '--linker', self.linker,
145 instructions_file_path,
146 ' ; ' + nuc_path + '/nuc'
147 ]
149 # Run Biobb block
150 self.run_biobb()
152 # Copy files to host
153 self.copy_to_host()
155 # remove temporary folder(s)
156 self.tmp_files.extend([
157 self.stage_io_dict.get("unique_dir"),
158 self.tmp_folder,
159 "nab.log",
160 "tleap.out"
161 ])
162 self.remove_tmp_files()
164 self.check_arguments(output_files_created=True, raise_exception=False)
166 return self.return_code
169def nab_build_dna_structure(output_pdb_path: str,
170 properties: dict = None, **kwargs) -> int:
171 """Create :class:`NabBuildDNAStructure <nab.nab_build_dna_structure.NabBuildDNAStructure>`nab.nab_build_dna_structure.NabBuildDNAStructure class and
172 execute :meth:`launch() <nab.nab_build_dna_structure.NabBuildDNAStructure.launch>` method"""
174 return NabBuildDNAStructure(output_pdb_path=output_pdb_path,
175 properties=properties).launch()
178def main():
179 parser = argparse.ArgumentParser(description='Building a 3D structure from a DNA sequence using nab.', formatter_class=lambda prog: argparse.RawTextHelpFormatter(prog, width=99999))
180 parser.add_argument('--config', required=False, help='Configuration file')
182 # Specific args
183 required_args = parser.add_argument_group('required arguments')
184 required_args.add_argument('--output_pdb_path', required=True, help='Linear (unfolded) 3D structure PDB file. Accepted formats: pdb.')
186 args = parser.parse_args()
187 config = args.config if args.config else None
188 properties = settings.ConfReader(config=config).get_prop_dic()
190 # Specific call
191 nab_build_dna_structure(output_pdb_path=args.output_pdb_path,
192 properties=properties)
195if __name__ == '__main__':
196 main()